Proceedings of the International scientific and practical conference ― Education and Scientific Progress‖ (February 13-15, 2026) / Publisher website: www.naukainfo.com. - Manchester, United Kingdom, 2026. - 206 p.
80 experimental groups (70 animals): control (10 individuals) and immobilization water immersion stress model [1]. Animals were removed from the experiment after 0.5, 1, 2, 3 h of stress exposure and after 12 and 24 h after its withdrawal. Total RNA was isolated according to the Chomczynski method [4]. Catalase activity was determined by the ability of hydrogen peroxide to form a stable colored complex with molybdenum salts [5]. Real-time RT-PCR was performed using the ―Thermo Scientific Verso SYBR Green 1-Step qRT-PCR ROX Mix kit‖ (―Thermo Scientific‖, Lithuania) according to the manufacturer's protocol: cDNA synthesis 50 ºС – 30 min; initial denaturation 95 ºС – 15 min; 40 cycles: DNA denaturation 95 ºС – 15 s; annealing 50 ºС – 35 s; elongation 72 ºС – 30 s. The following primer sequences were used: for Gast forward – GCCCAGCCTCTCATCATC and reverse – GGGGACAGGGCTGAAGTG; for Actb (endogenous control) forward – TGGGACGATATGGAGAAGAT and reverse – ATTGCCGATAGTGATGACCT. The amplification efficiency, calculated by the formula (Ex = (10 -1/slope ) - 1), was the same – 83%; slope = -3.8. Melting curve analysis was used to avoid the formation of primer dimers. The relative gene expression level was normalized to the expression of Actb and calculated using the ―ΔΔC T Method‖ [6]. Normally distributed data were calculated using One-way ANOVA (GraphPad Prism 8.4.3, GraphPad Software Inc., USA). Results are presented as arithmetic mean ± standard deviation. Results were considered significant at p ≤ 0.05. We found a significant increase in catalase activity in the cells of the gastrointestinal tract under the conditions of occurrence (1.2, 1.3, 1.6 and 2 times after 0.5, 1, 2 and 3 hours of exposure to the factor, respectively) and healing (1.4 and 1.2 times after 12 and 24 hours after cessation of exposure, respectively, p ≤ 0.001) of stress-induced gastric lesions, which indicates significant disorders of the functioning of the antioxidant system in the body. Therefore, changes in the above-mentioned biochemical indicator characterize the state of the body and provide grounds to establish the prerequisites for both disorders in the gastrointestinal tract under the conditions of stress-induced lesions and the healing process.
Made with FlippingBook
RkJQdWJsaXNoZXIy MTAxMzIwNA==